Journal: Journal of cell science

Article Title: CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi.

doi: 10.1242/jcs.154542

Figure Lengend Snippet: Fig. 2. CD44 shRNA effectively knocks down rat CD44 expression. (A) Immunoblot of cellular lysates of HEK293 cells co-transfected with rat CD44–GFP, b-galactosidase and pSuper (1) or CD44 shRNA #1963 (2) and #90 (3) plasmids. n53 independent batches of cells. (B) Quantitative densitometry of protein expression, normalized to GAPDH. (C) Primary hippocampal neurons transfected with pSuper or CD44 shRNA plasmids together with b-actin–GFP were subjected to immunocytochemistry using the anti- CD44 antibody (red). The arrowheads indicate transfected cells. Scale bar: 10 mm. (D) The effect of CD44 knockdown was estimated based on the average intensity of the CD44 immunofluorescence (IF) signal in transfected cells. n525 neurons per group. AU, arbitrary units. Data in B,D show the mean6s.e.m.; *P,0.05; ***P,0.001.

Article Snippet: The following mammalian expression plasmids have been described previously: pSuper vector (Brummelkamp et al., 2002), b-actin-GFP (Jaworski et al., 2005), b-actin-RFP (Hoogenraad et al., 2007), EFa-b-gal Jo ur na l o f C el l S ci en ce (Konopka et al., 2005) and pLNCX chick src Y527F (constitutively active Src; Addgene plasmid 13660; http://www.addgene.org/13660/).

Techniques: shRNA, Expressing, Western Blot, Transfection, Immunocytochemistry, Knockdown, Immunofluorescence

Journal: Journal of cell science

Article Title: CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi.

doi: 10.1242/jcs.154542

Figure Lengend Snippet: Fig. 3. Knockdown of CD44 stimulates the elaboration of dendrites of hippocampal neurons, and the effect of silencing is rescued by overexpression of an shRNA-resistant rat CD44. (A) Tracings of representative neurons co-transfected with pSuper, CD44 shRNA or CD44 shRNA/CD44Rescue together with RFP-coding vector. Scale bar: 50 mm. (B) Total dendritic length (TDL) and (C) total number of dendritic tips (TNDT) for neurons treated as in A. (D) Sholl analysis of hippocampal neurons after transfection with the indicated plasmids. At distances 25–175 mm from the cell body, the differences between CD44 shRNA and the other groups were statistically significant (P,0.001). Data show the mean6s.e.m. (n550 neurons per group); ***P,0.001.

Article Snippet: The following mammalian expression plasmids have been described previously: pSuper vector (Brummelkamp et al., 2002), b-actin-GFP (Jaworski et al., 2005), b-actin-RFP (Hoogenraad et al., 2007), EFa-b-gal Jo ur na l o f C el l S ci en ce (Konopka et al., 2005) and pLNCX chick src Y527F (constitutively active Src; Addgene plasmid 13660; http://www.addgene.org/13660/).

Techniques: Knockdown, Over Expression, shRNA, Transfection, Plasmid Preparation

Journal: Journal of cell science

Article Title: CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi.

doi: 10.1242/jcs.154542

Figure Lengend Snippet: Fig. 4. CD44 regulates the development of proper dendritic morphology in vivo. Rat pups were electroporated in vivo on P0 with pSuper/GFP or CD44 shRNA/GFP plasmids and sacrificed on P21. (A) Representative images of cortical neurons are presented. The regions outlined in white are shown at higher magnification as indicated. Scale bars: 100 mm (middle panel), 50 mm (right panel). Also shown is quantitative analysis of (B) total dendritic length and (C) Sholl analysis, (D) total length of apical dendrites (apical dendrite with branches), (E) apical dendrite length, (F) number of apical dendrite branches, (G) total length of basal dendrites, (H) mean length of basal dendrites and (I) number of basal dendrites of transfected cells. Morphometric analysis was performed with 20 neurons, with 3 animals per group. In the Scholl analysis, the differences between CD44 shRNA and pSuper were statistically significant (P,0.01) at distances 80–180 mm from the cell body. Data show the mean6s.e.m.; *P,0.05; **P,0.01; ns, not significant.

Article Snippet: The following mammalian expression plasmids have been described previously: pSuper vector (Brummelkamp et al., 2002), b-actin-GFP (Jaworski et al., 2005), b-actin-RFP (Hoogenraad et al., 2007), EFa-b-gal Jo ur na l o f C el l S ci en ce (Konopka et al., 2005) and pLNCX chick src Y527F (constitutively active Src; Addgene plasmid 13660; http://www.addgene.org/13660/).

Techniques: In Vivo, shRNA, Transfection

Journal: Journal of cell science

Article Title: CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi.

doi: 10.1242/jcs.154542

Figure Lengend Snippet: Fig. 5. Dispersion of the Golgi in neurons following CD44 knockdown. (A) Confocal images and Golgi three-dimensional reconstructions of GM130-labeled cultured hippocampal neurons transfected with pSuper or CD44 shRNA plasmids together with GFP-coding vector. After fixation, the cells were immunostained to visualize the Golgi marker GM130 (blue) and CD44 (red). Arrowheads indicate a transfected cell. Scale bar: 10 mm. (B) Quantification of the mean volume of the Golgi fragments. (C) Quantification of the number of Golgi fragments. (D) The ratio of the total surface area to total volume of the Golgi of cells transfected with pSuper, CD44 shRNA or CD44Rescue plasmids. Analyses of the Golgi of 40 cells for each experimental condition were performed. Data show the mean6s.e.m.; **P,0.01; ***P,0.001.

Article Snippet: The following mammalian expression plasmids have been described previously: pSuper vector (Brummelkamp et al., 2002), b-actin-GFP (Jaworski et al., 2005), b-actin-RFP (Hoogenraad et al., 2007), EFa-b-gal Jo ur na l o f C el l S ci en ce (Konopka et al., 2005) and pLNCX chick src Y527F (constitutively active Src; Addgene plasmid 13660; http://www.addgene.org/13660/).

Techniques: Dispersion, Knockdown, Labeling, Cell Culture, Transfection, shRNA, Plasmid Preparation, Marker

Journal: Journal of cell science

Article Title: CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi.

doi: 10.1242/jcs.154542

Figure Lengend Snippet: Fig. 7. CD44 knockdown-induced Golgi fragmentation is prevented by the activation of Src kinase and inhibition of actin polymerization. (A) Golgi three-dimensional reconstructions of GM130-labeled cultured hippocampal neurons transfected with pSuper, CD44 shRNA and CD44 shRNA/CASrc (Y527F) plasmids together with GFP-coding vector- or CD44 shRNA-transfected cells treated with latrunculin B (lat B). Scale bar: 10 mm. Quantification of (B) the number of Golgi fragments, (C) the mean volume of the Golgi fragments and (D) the ratio of total surface area to total volume of the Golgi. Analyses of the Golgi of 40 cells per each experimental condition were performed. Data show the mean6s.e.m.; ***P,0.001.

Article Snippet: The following mammalian expression plasmids have been described previously: pSuper vector (Brummelkamp et al., 2002), b-actin-GFP (Jaworski et al., 2005), b-actin-RFP (Hoogenraad et al., 2007), EFa-b-gal Jo ur na l o f C el l S ci en ce (Konopka et al., 2005) and pLNCX chick src Y527F (constitutively active Src; Addgene plasmid 13660; http://www.addgene.org/13660/).

Techniques: Knockdown, Activation Assay, Inhibition, Labeling, Cell Culture, Transfection, shRNA, Plasmid Preparation

Journal: Journal of cell science

Article Title: CD44 regulates dendrite morphogenesis through Src tyrosine kinase-dependent positioning of the Golgi.

doi: 10.1242/jcs.154542

Figure Lengend Snippet: Fig. 8. Partial protective effect of CD44 knockdown on young hippocampal neurons treated with a subtoxic concentration of glutamate. Neurons were transfected with pSuper, CD44 shRNA, CD44 shRNA/CASrc (Y527F) or pSuper/CASrc plasmids together with GFP-coding vector on DIV2 and treated with 50 mm glutamate (Glu) for 3 days. Control neurons (non-treated) and glutamate- treated neurons were fixed on DIV5. (A) Tracings of representative neurons for all groups. Scale bar: 50 mm. (B) Total dendritic length (TDL) and (D) total number of dendritic tips (TNDT) for neurons treated as in A. (C) Sholl analysis of hippocampal neurons after transfection with the indicated plasmids. The detailed data of the statistical analysis are presented in supplementary material Tables S1– S3. Data show the mean6s.e.m. (n550 neurons per group); ***P,0.001.

Article Snippet: The following mammalian expression plasmids have been described previously: pSuper vector (Brummelkamp et al., 2002), b-actin-GFP (Jaworski et al., 2005), b-actin-RFP (Hoogenraad et al., 2007), EFa-b-gal Jo ur na l o f C el l S ci en ce (Konopka et al., 2005) and pLNCX chick src Y527F (constitutively active Src; Addgene plasmid 13660; http://www.addgene.org/13660/).

Techniques: Knockdown, Concentration Assay, Transfection, shRNA, Plasmid Preparation, Control

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: PIWIL4 is widely highly expressed in TNBCs. A–C, expression of PIWIL1 (A), PIWIL2 (B), and PIWIL4 (C) in seven breast cancer cell lines and a noncancerous breast cell line, MCF-10A. D–F, expression of PIWIL1 (D), PIWIL2 (E), and PIWIL4 (F) in 20 pairs of breast cancer samples (C) and their paired normal samples (N). *, p < 0.05; **, p < 0.01 compared with the controls.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques: Expressing

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: PIWIL4 expression is highly correlated with breast cancer fatality and distant metastasis fatality. A–C, clinical overall survival and distant metastasis-free and post-progression survival of breast cancer patients with the top versus the lower two tertile (labeled high and low, respectively) expression levels of PIWIL1 (A), PIWIL2 (B), and PIWIL4 (C). The data resource was the KM-plotter database. P, log-rank p; HR, hazard ratio.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques: Expressing, Labeling

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: PIWIL4 is localized in the cytoplasm and exists in multiple isoforms in MDA-MB-231 cells. A, expression of PIWIL4 in the cytoplasm and nucleus of MDA-MB-231 cells, as indicated by subcellular fractionation and Western blotting analysis, in which Actin and TBP were used as cytoplasmic and nuclear markers, respectively. Con, control MDA-MB-231 cells transfected with an empty plasmid; OE, MDA-MB-231 cells with PIWIL4 overexpression via transfection. B, immunofluorescence staining of PIWIL4 and hDcp1a (a P body marker) in MDA-MB-231 cells. C, six PIWIL4 mRNA isoforms of PIWIL4 in MDA-MB-231 cells, with deletions, insertions, and stop codons indicated. PIWIL4 is the wild-type, full-length isoform. PL4L9 has a portion of intron inserted before exon 9. PL4L13 has a cytosine C deletion in the 566 site (red star). The insert sequence in PL4L13 is 5′-GTACTAAAAATATAGCAATGTGGGTGGGCTCCAAGGACTGTTCCTTCAGACCTCAAATCCACATGCTTATAGAAGACCACATAG-3′. The insert sequence in PL4L15 is 5′-GCCAAGAGCTGTTCCCAAAGGCCAAGCCCAAGGTTTGCACGAAGCTCCTCCAAGGAGTTCCAAACTTGAGATCACAGGACAAAGACTAGTCTGAAGTGTGATGGCTCCCTACTCCCAGCACCATGAAGCCAGAGTGACTTTTCACTCCATCCTCCCCAGTGAGCTTAAGTTCCCA-3′. The lessons in other isoforms are self-evident from the figure. D, four PIWIL4 protein isoforms corresponding to the six mRNA isoforms. AA, amino acids.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques: Expressing, Fractionation, Western Blot, Transfection, Plasmid Preparation, Over Expression, Immunofluorescence, Staining, Marker, Sequencing

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: PIWIL4 inhibits MDA-MB-231 cell apoptosis and promotes migration. A, diagram of the pSuper-shRNA knockdown system with three sense shRNA sequences of PIWIL4. PGK, phosphoglycerate kinase. B, the mRNA level and protein level of MDA-MB-231 cells transfected with shPIWIL4–1, -2, and -3 and shCon (an empty vector control) for 48 h. C, growth curve of MDA-MB-231 cells with shPIWIL4–1, -2, and -3 and shCon. OD, optical density. D, clone formation assay of MDA-MB-231 cells expressing shCon or shPIWIL4–1, -2, and -3. Colonies were counted after 10 days, indicating that PIWIL4 knockdown reduced the colony formation ability by up to 2-fold. E, protein levels of phosphorylated CHK2 and phosphorylated CDC2, p27, E-cadherin, N-cadherin, and cleaved caspase 3 in MDA-MB-231 cells expressing shCon and shPIWIL4. F, flow cytometry analysis of cell apoptosis using Annexin V and 7-amino-actinomycin D (7AAD) as early and late apoptotic markers, respectively. G, scratch assay indicating the wound healing results (i.e. migratory ability) of MDA-MB-231 cells transfected with shCon and shPIWIL4–1, -2, and -3. H, transwell assay of MDA-MB-231 cells expressing shCon or shPIWIL4–1, -2, and -3, showing that PIWIL4 knockdown significantly hampered cell migration. *, p < 0.05; **, p < 0.01 compared with the controls.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques: Migration, shRNA, Transfection, Plasmid Preparation, Tube Formation Assay, Expressing, Flow Cytometry, Wound Healing Assay, Transwell Assay

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: PIWIL4 is essential for activation of TGF-β and FGF signaling in MDA-MB-231 cells. A, heat map of 732 differentially expressed mRNAs between MDA-MB-231 cells with and without shPIWIL4–3 treatment. Green labeled 0 indicates the lowest expression level, red labeled 4 indicates the highest expression level, and the index was an arbitrary unit. B, heat map of the 60 most differentially expressed mRNAs between MDA-MB-231 cells with and without shPIWIL4–3 treatment. C, Venn diagram of three different PIWIL4 knockdown samples and control MDA-MB-231 cells. The blue circle (also appears in other colors because of the overlap with the green and tan circles) indicates 5397 proteins detected in MDA-MD-231 cells treated with shRNA vector only. The green circle (which appears as dark tan (207) and dark brown because of the overlap with the blue and tan circles) indicates a total of 2571 proteins detected in all three MDA-MB-231 shPIWIL4 samples. The tan circle (which also appears in three other different colors because of the overlap with the blue and green circles) indicates 7094 proteins that appear in at least one of the three MDA-MB-231 shPIWIL4 samples. D, reactome and KEGG pathway analysis from of 207 up-regulated proteins by an online tool, with p < 0.0001, which showed that components of the translational machinery are significantly enriched. E, reactome pathway analysis of 1288 down-regulated proteins by an online tool, with p < 0.01, which showed that the TGF-β and FGF signaling pathways are significantly enriched. F, TGFβR1, TGFβR2, FGFR2, TGFβ1, and TGFβ3 mRNA levels in the three PIWIL4 knockdown samples are down-regulated in three PIWIL4 knockdown cells compared with the control. *, p < 0.05; **, p < 0.01. G, gene ontology analysis of 1495 differentially expressed proteins by an online tool, with p < 0.01.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques: Activation Assay, Labeling, Expressing, shRNA, Plasmid Preparation

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: Analysis of piRNAs in MDA-MB-231 cells. A, pie chart illustrating the genomic source annotation of all mapped sequences. B, the size profile of the “others” group sequences. The 24- to 32-nt size range for putative piRNAs is shadowed in gray. The abundance was normalized to 1 million in each sample for comparison. C, donut display of known piRNAs (known) versus putative piRNAs (new) in the 24- to 32-nt population from the “others” group. D, nucleotide preference profile of 24- to 32-nt putative RNAs from position 1 to position 24. E, annotation of putative RNAs from the “others” group. nc, noncoding; TE, transposons. F, scatter plot of the ratio of all newly identified known and putative RNAs that had at least 10 mappable reads in either normal or PiwiL4 knockdown MDA-MB-231 cells. Red dashed lines correspond to log2 value 1, −1.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques:

Journal: The Journal of Biological Chemistry

Article Title: The Role of PIWIL4, an Argonaute Family Protein, in Breast Cancer *

doi: 10.1074/jbc.M116.723239

Figure Lengend Snippet: A proposed regulation mechanism of PIWIL4 in the breast cancer cell line MDA-MB-231. PIWIL4 could promote breast cancer cell survival, proliferation, epithelial-to-mesenchymal transition (EMT), and migration by activation of the TGF-β, FGF, and MAPK/ERK signaling pathways. Meanwhile, PIWIL4 might repress MHC class II, which helps cancer cells avoid immune recognition and reaction.

Article Snippet: PIWIL4 shRNA Knockdown Analysis RNAi vector pSUPER-puro was purchased from Promega.

Techniques: Migration, Activation Assay